Review



human aβ40  (Elabscience Biotechnology)


Bioz Verified Symbol Elabscience Biotechnology is a verified supplier
Bioz Manufacturer Symbol Elabscience Biotechnology manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Elabscience Biotechnology human aβ40
    Human Aβ40, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 71 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/Human+A%CE%B21-40+(Amyloid+Beta+1-40)+ELISA+Kit/pm42044561-121-13-21
    Average 94 stars, based on 71 article reviews
    human aβ40 - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Enzyme-linked Immunosorbent Assay:

    Article Title: miR-181c-5p suppresses neuronal pyroptosis via NLRP1 in Alzheimer's disease.
    Article Snippet: Alzheimer’s disease (AD) is neurodegenerative disease common in the elderly, whose pathological mechanism is the deposition of amyloid-β (Aβ) plaques and neurofibrillary tangles in the brain.. Pyroptosis is a programmed cell death mediated by Gasdermin protein.. After the activation of inflammasomes, the cleaved caspase⁃ 1/4/5/11 activates GSDMD, which promotes the release of inflammatory substances and eventually causes cell swelling and death.

    Article Title: Modulation of neuronal α1-adrenergic receptor reduces tauopathy and neuroinflammation by inhibiting the STING/NF-κB/NLRP3 signaling pathway in Alzheimer’s disease mice
    Article Snippet: .. Supernatants were collected from each experimental group and protein concentrations of IL-1β (E-EL-H0149 and E-EL-M0037, Elabscience), IL-6 (E-EL-H6156, Elabscience), IL-18 (E-EL-H0253 and E-EL-M0730, Elabscience), Aβ40 (E-EL-H0542, Elabscience) and Aβ42 (E-EL-H0543, Elabscience) were quantified using commercially available ELISA kits following the manufacturer's instructions. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Effect of alternating nicotinamide phosphoribosyltransferase expression levels on mitophagy and pathological symptoms in Alzheimer’s disease mouse models
    Article Snippet: .. Table 1 Primer pairs used for qPCR experiment Gene Forward Primer Reverse Primer mtDNA CAAACCTACGCCAAAATCCA GAAATGAATGAGCCTACAGA nDNA ACGGACCAGAGCGAAAGCA GACATCTAAGGGCATCACAGAC β-actin CCTCTATGCCAACACAGTGC CCTGCTTGCTGATCCACATC 2.11 Enzyme-Linked Immunosorbent Assay The levels of Aβ40 (Elabscience, E-EL-M3009), Aβ42 (Elabscience, E-EL-M30010), SIRT1 (mlbio, ml037854, Shanghai, China), NAD+ (mlbio, ml058523, Shanghai, China), NADH (mlbio, ml058809, Shanghai, China) in the hippocampal tissue were quanti ed using an enzyme-linked immunosorbent assay kit according to the manufacturer’s instructions. ..



    Similar Products

    lumipulse g b-amyloid 1-40 plasma  (Fujirebio Inc)
    95
    Fujirebio Inc lumipulse g b-amyloid 1-40 plasma
    Lumipulse G B Amyloid 1 40 Plasma, supplied by Fujirebio Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/Lumipulse+G+b-Amyloid+1-40+Plasma/custom%4081298%4042449187
    Average 95 stars, based on 1 article reviews
    lumipulse g b-amyloid 1-40 plasma - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    anti aβ40  (Agrisera)
    86
    Agrisera anti aβ40
    Anti Aβ40, supplied by Agrisera, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/anti+a%CE%B240/pm42261875-66-23-25
    Average 86 stars, based on 1 article reviews
    anti aβ40 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    enzyme linked immunosorbent assay elisa aβ40  (Thermo Fisher)
    97
    Thermo Fisher enzyme linked immunosorbent assay elisa aβ40
    Enzyme Linked Immunosorbent Assay Elisa Aβ40, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/Amyloid+beta/pm42260548-108-0-19
    Average 97 stars, based on 1 article reviews
    enzyme linked immunosorbent assay elisa aβ40 - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier
    aβ40 peptides  (Sangon Biotech)
    86
    Sangon Biotech aβ40 peptides
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Aβ40 Peptides, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/a%CE%B240+peptides/pmc13150991-41-2-20
    Average 86 stars, based on 1 article reviews
    aβ40 peptides - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    human aβ40  (Elabscience Biotechnology)
    94
    Elabscience Biotechnology human aβ40
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Human Aβ40, supplied by Elabscience Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/Human+A%CE%B21-40+(Amyloid+Beta+1-40)+ELISA+Kit/pm42044561-121-13-21
    Average 94 stars, based on 1 article reviews
    human aβ40 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    plasma aβ42 aβ40  (Biofluids Inc)
    86
    Biofluids Inc plasma aβ42 aβ40
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Plasma Aβ42 Aβ40, supplied by Biofluids Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/a%CE%B240+a%CE%B242+plasma/pmc13001047-614-11-8
    Average 86 stars, based on 1 article reviews
    plasma aβ42 aβ40 - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    aβ40  (Quanterix)
    96
    Quanterix aβ40
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Aβ40, supplied by Quanterix, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/Neuro+3-Plex+A+Kit/pmc13093639-73-23-8
    Average 96 stars, based on 1 article reviews
    aβ40 - by Bioz Stars, 2026-10
    96/100 stars
    		  Buy from Supplier
    aβ42 aβ40 ratio  (Quest Diagnostics)
    86
    Quest Diagnostics aβ42 aβ40 ratio
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Aβ42 Aβ40 Ratio, supplied by Quest Diagnostics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/a%CE%B240+a%CE%B242+ratio/pmc13272826-74-6-32
    Average 86 stars, based on 1 article reviews
    aβ42 aβ40 ratio - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    aβ40 aptamers  (Sangon Biotech)
    86
    Sangon Biotech aβ40 aptamers
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Aβ40 Aptamers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/aptamers+a%CE%B240/pm41747767-36-0-5
    Average 86 stars, based on 1 article reviews
    aβ40 aptamers - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    aβ40 enzyme linked immunosorbent assay elisa kit  (Macklin Inc)
    86
    Macklin Inc aβ40 enzyme linked immunosorbent assay elisa kit
    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of <t>Aβ40</t> biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).
    Aβ40 Enzyme Linked Immunosorbent Assay Elisa Kit, supplied by Macklin Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/a%CE%B240/dehydrogenase+glucose/pm41747767-32-11-23
    Average 86 stars, based on 1 article reviews
    aβ40 enzyme linked immunosorbent assay elisa kit - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results


    Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of Aβ40 biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).

    Journal: RSC Advances

    Article Title: Graphene field-effect transistor based multiplexed sensing platform for simultaneous detection of multiple Alzheimer's disease biomarkers

    doi: 10.1039/d5ra07384g

    Figure Lengend Snippet: Mixed sample detection results. (a) Higher concentration of Aβ42 biomarker vs. lower concentration of hsa-miR-125b biomarker. The absolute concentrations were (Aβ42 : 125b): 10 pM : 1 fM (10 000 : 1); 50 nM : 50 pM (1000 : 1); and 100 nM : 1 nM (100 : 1). (b) Higher concentration of hsa-miR-125b biomarker vs. lower concentration of Aβ42 biomarker. The absolute concentrations were (125b : Aβ42): 100 nM : 1 fM (10 8 : 1), 100 nM : 1 pM (10 6 : 1), and 50 nM : 50 pM (10 3 : 1). (c) Fixed concentration of Aβ40 biomarker and varying concentrations of hsa-miR-125b ( n ≥ 13, n is number of sensors used for each measurement).

    Article Snippet: Aβ42 and Aβ40 peptides, hsa-miR-125b RNA sequence, the hsa-miR-125b complementary DNA probe and the Aβ42 DNA aptamer were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

    Techniques: Concentration Assay, Biomarker Discovery